Department of Clinical Bacteriology, Göteborg University, Guldhedsgatan 10, S-413 46 Göteborg, Sweden
Abstract
A random amplified polymorphic DNA (RAPD) PCR method was developed for the identification of Escherichia coli strains in the normal human intestinal microflora. Bacteria amounting to approximately one tenth of a colony were added directly to the PCR mixture and disrupted by heating. Taq polymerase was added and PCR was run using a single 10nt primer. The PCR products were separated by polyacrylamide gel electrophoresis, which gave complex band patterns suitable for computer-aided cluster analysis using the Pearson products moment correlation coefficient (i) and the unweighted pair group method with arithmetic averages (UPGMA). The intestinal E. coli flora of five infants followed from birth to 6 months' age was analyzed by RAPD. Two isolates were considered to be members of different strains if showing less than 80% similarity in this analysis, as strain differentiation based on this cut-off point coincided largely with strain grouping based on multilocus enzyme electrophoreis. This RAPD method should, thus, be suitable for epidemiological studies of the intestinal E. coli flora.
Introduction
Microbial ecology denotes the study of complex microbial communities, such as the microflora inhabiting the human large intestine. The normal intestinal microflora does not only contain an immense number of bacterial species. At a given point in time, several clones, or strains, of the same species may also coexist. For example, an individual typically harbours one to ten different E. coli strains simultaneously (Vosti et al., 1964; Ochman et al., 1983). Some of these strains have the capacity to persist in the colonic microflora for extended periods of time (resident strains), while others are not capable of long term colonization (transient strains) (Sears et al., 1949; Sears and Brownlee, 1951; Sears et al., 1956). Thus, the study of the normal human microflora does not only require techniques for the reliable identification of different bacterial species, but also methods to distinguish between different strains of the same species. E. coli strains in the normal intestinal microflora have been identified by extended serotyping (Sears and Brownlee, 1951; Sears et al., 1956), by multilocus enzyme electrophoresis (MLEE) (Ochman et al., 1983; Whittam et al., 1983; Wold et al., 1992; Adlerberth et al., 1998) or by biotyping (Kühn and Möllby, 1986; Tullus et al., 1991).
During the last years, a number of typing methods based on the heterogeneity of bacterial DNA have been developed. Restriction fragment length polymorphism (RFLP) is regarded as the most sensitive method for strain identification (Dorn and Angrick, 1991; Samadpour et al., 1993). However, this method is complicated, time-consuming and expensive (Williams et al., 1990; Pfaller, 1991; Birch et al., 1996), and has not been applied to analyses of the intestinal microflora.
Random Amplified Polymorphic DNA (RAPD) is a PCR based method which can be used to distinguish between strains within a species. One or a few short primers of arbitrary sequence are allowed to bind under low stringency conditions to various sites on both strands of the template DNA. The PCR reaction yields a series of products of varying size, which may be separated by gel electrophoresis. The band pattern represents a "genetic fingerprint" characterizing a particular bacterial strain (Welsh and McClelland, 1990).
RAPD has lower discriminatory capacity than RFLP (Johansson et al., 1995) and a single primer has mostly not proven sufficient to yield band patterns complex enough to permit the separation of different E. coli strains (Birch et al., 1996; Kärkkäinen et al., 1996). A solution has been to run a series of RAPD analyses with different primers and combine the patterns (van Belkum et al., 1994; Desjardins et al., 1995; Kärkkäinen et al., 1996; Pacheco et al., 1997a), but this reduces the speed and cost effectiveness of the method.
The aim of the present study was to design a RAPD typing method suitable for rapid screening of intestinal E. coli isolates directly from primary cultures. A single primer should be used, and computer-aided analysis employed to exclude observer bias. Such a method was developed, using a collection of intestinal E. coli previously analyzed by multilocus enzyme electrophoresis.
Results
Comparison Between Agarose and Polyacrylamide Gel Electrophoresis
Figure 1 shows the results of RAPD analysis of ten different intestinal E. coli strains using one 10-mer primer (primer no. 10, Kit A, Operon Technologies). The PCR products were separated either by agarose or by polyacrylamide gel electrophoresis. The band patterns of the ten strains differed clearly from one another using either polyacrylamide (Figure 1a) or agarose gel electrophoresis (Figure 1 b), but the band patterns were much more complex with the former than the latter method. Specially, fragments in the low molecular weight range (234-453 bp) did not show up on the agarose gel (Figure 1a, b).
DNA Extraction
We compared prior lysis of bacteria for obtaining template DNA (Johansson
et al., 1995), with a simplified procedure
in which a small amount of bacteria from an agar-grown colony were suspended directly in the PCR mixture and
disrupted by heating before adding the Taq polymerase. In our hands, the simplified method gave as clear and reproducible
band patterns as prior lysis of bacteria (data not shown). In order to assess the number of bacteria we had added to the
PCR mixture, we performed viable counts. In six experiments, the number of bacteria picked was found to vary
between 2¥107 and
4¥107. We next prepared bacterial suspensions of varying concentrations and analyzed by PCR. The
PCR
pattern was found to be stable over the above range (data not shown).
Computer Aided Analysis of RAPD Patterns for the Identification of Intestinal E. coli Strains
We studied the applicability of the RAPD method for typing of intestinal E. coli strains by re-analyzing isolates from a longitudinal study of the E. coli flora of five newborn infants. The isolates from each child were previously analyzed by multilocus enzyme electrophoresis (MLEE) and grouped into different strains, of which some yielded repeated isolates (resident strains) and others were only found once (transient strains) (Adlerberth et al., 1998).
First, we sought to determine a cut-off point, below which two isolates could be considered as representing two different strains, instead of two isolates of the same strains. To this end, we compared strain grouping with RAPD, using different cut-off points, with results using MLEE. Figure 2 demonstrates the RAPD analysis of 22 intestinal E. coli isolates from one child. Employing 80% as the cut-off level, the 22 isolates were grouped into nine strains ("A"-"G") by RAPD. Previously, these isolates were grouped by MLEE into nine electrophoretic types, "I" to "IX" (child no 1, Figure 3). Thus, using 80% as cut-off, grouping of 21 out of 22 isolates from this child agreed between the two methods. The exception was one isolate ("D"/"V", child no 1, Figure 3). Using RAPD this isolate was grouped together with another isolate, comprising the "D" strain. Using electromorphic typing, the same isolate was instead grouped with a third isolate, these two isolates composing the strain "V". Other cut-off point (e.g.75% or 85%) gave less agreement between the two methods.
Comparisons between the two methods for analysis of the intestinal flora of all five infants are shown in Figure 3. To a large extent, the results from the two methods agreed, although isolates not distinguished by MLEE were separated using RAPD in eight cases. In three cases, isolates showing different enzyme electrophoretic patterns were not separated by RAPD.
Attempts to use agarose gel band patterns for computer-based analysis were not successful. Thus, repeated analyses of a single isolate of E. coli often gave electrophoretic patterns which, despite looking very similar to the naked eye, showed less similarity in computer-based analyses than two separate strains.
Discussion
The aim of the present study was to develop a RAPD-based typing method for E. coli suitable for identification of individual E. coli strains in the normal intestinal microflora. Similarity analyses of the electrophoretic patterns of the PCR products should be computer-based, in order to facilitate comparisons of large numbers of isolates and to eliminate inter-individual observer variation.
It was impossible for us to obtain band patterns in agarose gels that could be used for computer-aided analysis, but possible if the PCR products were instead separated on polyacrylamide gels and visualised by silver staining, which yielded much more complex bands. A sufficiency large number of bands is a prerequisite for adequate performance of computer-based band pattern analysis (Seward et al., 1997).
In one case a close relationship between two isolates (strain "D", Figure 2) was suggested by the program although the isolates looked different to the naked eye. The sensitivity of the program to background may cause this type of mismatch. This observation emphasises the continued need for manual assessment and interpretation of automated results as well as the need to ensure that findings are based on sufficiently complex fingerprints (Seward et al., 1997).
Despite the fact that polyacrylamide gel electrophoresis is more complicated than agarose gel electrophoresis, speed and cost-effectiveness were nevertheless increased, since the complex band patterns obtained permitted us to use a single primer for typing of E. coli strains. Although there are some previous reports on RAPD characterization of E. coli strains using a single primer and agarose electrophoresis, none of these studies have used computer-aided analysis of band patterns (Alos et al., 1993; Wang et al., 1993). Thus, we could not successfully apply computer based separation of E. coli strains when using one of these reported methods (Wang et al., 1993). Indeed, the use of multiple primers has been a prerequisite for efficient separation of E. coli by RAPD in most studies (van Belkum et al., 1994; Desjardins et al., 1995; Birch et al., 1996; Kärkkäinen et al., 1996; Pacheco et al., 1997b), which limits the usefulness of the methods.
The DNA extraction step was eliminated to increase speed and versatility. A small amount of bacteria, just enough to be clearly visible by the naked eye, was picked from a colony and suspended directly in the PCR mixture. The bacteria were disrupted by heating in the PCR mixture before the heat sensitive Taq polymerase was added. The use of E. coli whole-cell preparations for PCR has been described previously, e.g. in repetitive element sequence-based PCR (rep-PCR) for the typing of E. coli (Woods et al., 1993) and in multiplex PCR assays (Yamamoto et al., 1995). In the present study, the amount of bacteria added to the PCR mixture was found to vary between 2¥107 and 4¥107, in which range the PCR patterns showed satisfying stability. In accordance, Pacheco et al. found that similar amplification products were obtained over a rather large template concentration range (Pacheco et al., 1996), and a number of studies report reproducible RAPD results without prior quantification of bacterial DNA (Lawrence et al., 1993; Wong et al., 1994; Birch et al., 1996; Seward et al., 1997). Although standardizing the amount of template DNA may increase reproducibility (Ellsworth et al., 1993; Muralidharan and Wakeland, 1993; Brikun et al., 1994; Cavé et al., 1994), we believe that the possibility of directly screening bacteria from primary cultures gives a strong advantage to our simplified method.
The practical applicability of the RAPD method was tested by
re-analyzing E. coli isolates previously grouped
into different strains using multilocus enzyme electrophoresis (MLEE). These isolates were obtained from a
longitudinal study of the intestinal E.
coli flora of newborn infants (Adlerberth et
al., 1998). MLEE is based on differences in electrophoretic mobility between isoforms of cytoplasmic "housekeeping" enzymes. It is a well established and
reliable, but expensive and time consuming method (Ochman
et al., 1983; Selander et al., 1986), which has been used in
several epidemiological studies of intestinal E.
coli (Whittam et al., 1983; Wold et
al., 1992; Adlerberth et al., 1998). In our
hands, RAPD using polyacrylamide electrophoresis and computer-aided analysis of band patterns showed good
agreement with electromorphic typing for the identification of intestinal
E. coli strains, but was many times less labour intensive
and
expensive. We did not compare with a third method, such as RFLP, regarded as the most sensitive typing system for
a number of different bacterial species (Wachsmuth, 1986). We believe that although RFLP may be superior to
distinguish between strains which are very closely related, such a sensitive
method is not required to characterize the
normal intestinal E. coli flora, which in a certain individual represents a rather heterogeneous collection of strains (Caugant
et al., 1983).
Preliminary data indicate that the RAPD patterns of E. coli strains are stable upon intestinal colonization. Thus, ten different E. coli strains which were allowed to colonize germ-free rats for two weeks could be identified in cultures of the intestinal contents using their RAPD patterns (V. Herías, unpublished). In vivo stability of RAPD patterns has also been reported by others (Cavé et al., 1994; Kärkkäinen et al., 1996). This supports that RAPD is a method well suited for epidemiological studies of intestinal E. coli.
Experimental Procedures
Bacteria
A collection of E. coli isolated from the intestinal microflora of five newborn infants was used to develop and test the RAPD method (Adlerberth et al., 1998). Sampling of the rectal flora was performed on 12 occasions during the first 6 months of life. The isolates of each child had previously been grouped into different E. coli strains using multilocus enzyme electrophoresis (MLEE) based on the isoenzyme pattern of the following eight enzymes: malate dehydrogenase, 6-phospogluconate dehydrogenase, adenylate kinase, phosphoglucose isomerase, glucose 6-phosphate dehydrogenase, mannose phosphate isomerase, phenylalanyl-leucine peptidase and leucylglycyl-glycine peptidase. Using this method a number of different E. coli strains could be identified in each infant. Strains persisting in the intestinal flora for a period of time contributed several consecutive isolates, while transient strains were represented by a single isolate (Adlerberth et al., 1998).
Selection of Primer
Twenty different 10-mer primers (kit A, Operon Technologies, Alameda, CA) and the 20-mer primer D14307 (GGTTGGGTGAGAATTGCACG) described by Wang et al. (Wang et al., 1993) were tested for their capacity to discriminate between eight different E. coli strains from the collection of infant intestinal E. coli.
Primer no. 10 (GTGATCGCAG) was chosen because it generated the most discriminatory RAPD profiles for the eight E. coli strains. The 20-mer primer D14307 yielded less informative band patterns than primer no. 10, both under the PCR conditions described in the original paper (Wang et al., 1993) and under the conditions described below.
Optimization of PCR Reactants
Different concentrations of primer (4-9 mM), dNTP (0.1-0.4 mM) (Perkin Elmer, Branchburg, NJ), MgCl2 (1.5-6 mM) (Perkin Elmer) and Taq polymerase (1-3 U/ml) (Perkin Elmer) were tested, and the following concentrations were found to be optimal: 6 mM of primer, 0.1 mM dNTP, 2 U/ml Taq polymerase and 1.5 mM MgCl2. Higher concentration of MgCl2 decreased the numbers of informative bands (data not shown).
DNA Preparation and Amplification
Two methods were used to obtain bacterial DNA. First, bacteria were cultivated in broth, spun down, washed and lysed before addition to the PCR mixture (Johansson et al., 1995). Later, a simplified method was developed. A small amount of bacteria was picked from an agar-grown colony with the tip of a sterile syringe. The bacteria were suspended in a mixture of primer, nucleotides and MgCl2, in an autoclaved thin-wall reaction tube (Perkin Elmer). The tube was sealed with a drop of mineral oil and the mixture was heated for 10 min at 94° in a thermocycler (Perkin-Elmer Cetus Model 480) in order to disrupt the bacteria.
PCR Analysis
Taq polymerase (Ampli Taq, Perkin Elmer) was added and the PCR reaction was run using the following temperature profile: 94°C for 45 s; 30°C for 120 s; 72°C for 60 s for four cycles followed by 94°C for 5 s; 36°C for 30 s; 72°C for 30 s for 26 cycles (the extension step was increased by 1 s for every new cycle). The PCR reaction was terminated at 72°C for 10 min and thereafter cooled to 4°C (Johansson et al., 1995).
Gel Electrophoresis
For separation of the PCR products, agarose and polyacrylamide gel electrophoresis were compared. Agarose gel electrophoresis was performed using 1.5% agarose gel as previously described (Johansson et al., 1995).
For polyacrylamide gel electrophoresis, 8% ready-made Tris-Glycine gels (Novex, Frankfurt, Germany) were applied in a vertical electrophoresis apparatus and loaded with 6.3 ml of sample and 0.7 ml of loading buffer (Gel loading solution, Sigma). DNA marker VI (Boehringer Mannheim) was used as a molecular weight standard. The electrophoresis was run for 10 min at a constant voltage of 20 V, followed by 90V for 2 h 15 min in a Tris-glycine running buffer (Tris base 0.24 M, glycine 1.9 M, SDS 0.035 M, pH 8.3). DNA was visualized by silver staining (plusOne DNA silver staining kit, Pharmacia Biotech, Uppsala, Sweden) whereafter the polyacrylamide gel was dried (Dry Ease Gel Drying System, Novex).
Computer-Aided Gel Analysis
Agarose and polyacrylamide gels were scanned in a laser densitometer (Studio Scan II Si Agfa, MacForum, Göteborg, Sweden) and analysed by the Gel Compare 4.0 programme (Applied Maths, Kortrijk, Belgium) (Johansson et al., 1995). Similarity matrices were calculated using the Pearson Product-moment correlation coefficient and the isolates were clustered by the unweighted average pair group method (UPGMA) using arithmetic averages (Seward et al., 1997).
Acknowledgements
We thank Siv Ahrné and Mikael Quednau at the Department of Food Technology, Lund University, for expert advice on RAPD and computer-based analysis and we are grateful to Hans-Jürg Monstein at the Department of Clinical Microbiology, Linköping University, for critically reading the manuscript. The study was supported by grants from the Swedish Medical Research Council (no. K98-06X-12612-01A), the Swedish Association for Research on Agriculture and Forestry, the Swedish Foundation for Health Care Science and Allergy Research and the Ellen, Walter and Lennart Hesselman foundation.
References
Adlerberth, I., Jalil, F., Carlsson, B., Mellander, L., Hanson, L.å., Larsson, P., Khalil, K., and Wold, A.E. 1998. High turnover rate of Escherichia coli strains in the intestinal flora of infants in Pakistan. Epidemiol. Infect. 121: 587-598.
Alos, J.I., Lambert, T., and Courvalin, P. 1993. Comparison of two molecular methods for tracing nosocomial transmission of Escherichia coli K1 in a neonatal unit. J. Clin. Microbiol. 31: 1704-9.
Birch, M., Denning, D.W., and Law, D. 1996. Rapid genotyping of Escherichia coli O157 isolates by random amplification of polymorphic DNA. Eur. J. Clin. Microbiol and Infect. Dis. 15: 297-302.
Brikun, I., Suziedelis, K., and Berg, D.E. 1994. DNA sequence divergence among derivatives of Escherichia coli K-12 detected by arbitrary primer PCR (random amplified polymorphic DNA) fingerprinting. J. Bacteriol. 176: 1673-82.
Caugant, D.A. 1983. Enzyme Polymorphism in Escherichia Coli: Genetic structure of populations: Relationship with urinary tract infection strains and with Shigella. Thesis. Department of Clinical Immunology. University of Göteborg, Göteborg.
Caugant, D.A., Levin, B.R., Lidin-Janson, G., Whittam, T.S., Svanborg Eden, C., and Selander, R.K. 1983. Genetic diversity and relationship among strains of Escherichia coli in the intestine and those causing urinary tract infection. Prog. Allergy. 33: 203-227.
Cavé, H., Bingen, E., Elion, J., and Denamur, E. 1994. Differentiation of Escherichia coli strains using randomly amplified polymorphic DNA analysis. Res.Microbiol. 145: 141-50.
Desjardins, P., Picard, B., Kaltenböck, B., Elion, J., and Denamur, E. 1995. Sex in Escherichia coli does not disrupt the clonal structure of the population: evidence from random amplified polymorphic DNA and restriction-fragment-length polymorphism. J. Mol. Evol. 41: 440-8.
Dorn, C.R., and Angrick, E.J. 1991. Serotype O157:H7 Escherichia coli from Bovine and Meat Sources. J. Clin. Microbiol. 29: 1225-1231.
Ellsworth, D.L., Rittenhouse, K.D., and Honeycutt, R.L. 1993. Artifactual variation in randomly amplified polymorphic DNA banding patterns. Biotechniques. 14: 214-7.
Johansson, M.L., Quednau, M., Molin, G., and Ahrné, S. 1995. Randomly amplified polymorphic DNA (RAPD) for rapid typing of Lactobacillus plantarum strains. Lett. Appl. Microbiol. 21: 155-9.
Kühn, I., and Möllby, R. 1986. Phenotypic variations among enterotoxigenic O-groups of Escherichia coli from various human populations. Med. Microbiol. Immunol. 175: 15-26.
Kärkkäinen, U.M., Kauppinen, J., Ikäheimo, R., and Katila, M.L. 1996. Random amplified polymorphic DNA (RAPD) analysis of Escherichia coli strains: comparison of urinary and concomitant blood isolates of urosepsis patients. APMIS. 104: 437-43.
Lawrence, L.M., Harvey, J., and Gilmour, A. 1993. Development of a random amplification of polymorphic DNA typing method for Listeria monocytogenes. Appl. Environ. Microbiol. 59: 3117-9.
Muralidharan, K., and Wakeland, E.K. 1993. Concentration of primer and template qualitatively affects products in random-amplified polymorphic DNA PCR. Biotechniques. 14: 362-4.
Ochman, H., Whittam, T.S., Caugant, D.A., and Selander, R.K. 1983. Enzyme polymorphism and genetic population structure in Escherichia coli and Shigella. J. Gen. Microbiol. 129: 2715-26.
Pacheco, A.B., Guth, B.E., de Almeida, D.F., and Ferreira, L.C. 1996. Characterization of enterotoxigenic Escherichia coli by random amplification of polymorphic DNA. Res. Microbiol. 147: 175-82.
Pacheco, A.B., Guth, B.E., Soares, K.C., de Almeida, D.F., and Ferreira, L.C. 1997a. Clonal relationships among Escherichia coli serogroup O6 isolates based on RAPD. FEMS. Microbiology. Letters. 148: 255-60.
Pacheco, A.B., Guth, B.E., Soares, K.C., Nishimura, L., de Almeida, D.F., and Ferreira, L.C.S. 1997b. Random amplification of polymorphic DNA reveals serotype-specific clonal clusters among enterotoxigenic Escherichia coli strains isolated from humans. J. Clin. Microbiol. 35: 1521-5.
Pfaller, M.A. 1991. Typing methods for epidemiologic investigation. In: Manual Of Clinical Microbiology. A. Balows and J. Hausler, eds. American Society for Microbiology, Washington. p. 171-182.
Samadpour, M., Grimm, L.M., Desal, B., Alfi, D., Ongerth, J.E., and Tarr, P.I. 1993. Molecular epidemiology of Escherichia coli O157:H7 strains by bacteriophage l restriction fragment length polymorphism analysis: application to a multistate foodborne outbreak and a day-care center cluster. J. Clin. Microbiol. 31: 3179-3183.
Sears, H.J., Brownlee, E., and Uchiyama, J.K. 1949. Persistence of individual strains of Escherichia coli in the intestinal tract of man. J. Bacteriol. 59: 299-301.
Sears, H.J., and Brownlee, I. 1951. Further observations on the persistence of individual strains of Escherichia coli in the intestinal tract of man. J. Bacteriol. 63: 47-57.
Sears, H.J., James, H., Saloum, R., Brownlee, I., and Lamereaux, L.F. 1956. Persistence of individual strains of Escherichia coli in man and dog under varying conditions. J. Bacteriol. 71: 370-372.
Selander, R.K., Caugant, D.A., Ochman, H., Musser, J.M., Gilmour, M.N., and Whittam, T.S. 1986. Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics. Appl. Environ. Microbiol. 51: 873-84.
Seward, R.J., Ehrenstein, B., Grundmann, H.J. and Towner, K.J. 1997. Direct comparison of two commercially available computer programs for analysing DNA fingerprinting gels. J. Med. Microbiol. 46: 314-20.
Tullus, K., Kuhn, I., Orskov, I., Orskov, F., and Möllby, R. 1991. The importance of P and type 1 fimbriae for the persistence of Escherichia coli in the human gut. Epidemiol. Infect. 108: 415-421.
Wachsmuth, K. 1986. Molecular epidemiology of bacterial infections: Examples of methodology and of investigations of outbreaks. Rev. Infect. Dis. 8: 682-692.
Wang, G., Whittam, T.S., Berg, C.M., and Berg, D.E. 1993. RAPD (arbitrary primer) PCR is more sensitive than multilocus enzyme electrophoresis for distinguishing related bacterial strains. Nucl. Acids. Res. 21: 5930-3.
van Belkum, A., Bax, R., and Prevost, G. 1994. Comparison of four genotyping assays for epidemiological study of methicillin-resistant Staphylococcus aureus. Eur. J. Clin. Microbiol. Infect. Dis. 13: 420-4.
Welsh, J., and McClelland, M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucl. Acids. Res. 18: 7213-8.
Whittam, T.S., Ochman, H., and Selander, R.K. 1983. Multilocus genetic structure in natural population of Escherichia coli. Proc. Natl. Acad. Sci. USA. 80: 1751-1755.
Williams, J.G., Kubelik, A.R., Livak, K.J., Rafalski, J.A., and Tingey, S.V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucl. Acids. Res. 18: 6531-5.
Wold, A.E., Caugant, D.A., lidin-Janson, G., Man, P., and Svanborg, C. 1992. Resident colonic Escherichia coli strains frequently display urophatogenic characteristics. J. infect. Dis. 165: 46-52.
Wong, N.A., Linton, C.J., Jalal, H., and Millar, M.R. 1994. Randomly amplified polymorphic DNA typing: a useful tool for rapid epidemiological typing of Klebsiella pneumoniae. Epidemiol. Infect. 113: 445-54.
Woods, C.R., Versalovic, J., Koeuth, T., and Lupski, J.R. 1993. Whole-cell repetitive element sequence-based polymerase chain reaction allows rapid assessment of clonal relationships of bacterial isolates. J. Clin. Microbiol.1927-1931.
Vosti, K.L., Goldberg, L.M., Monto, A.S., and Rantz, L.A. 1964. Host-parasite interaction in patients with infections due to Escherichia coli. I. The serogrouping of E. coli from intestinal and extra-intestinal sources. J. Clin. Invest. 43: 2377-2385.
Yamamoto, S., Terai, A., Yuri, K., Kurazono, H., Takeda, Y., and Yoshida, O. 1995. Detection of Urovirulence factors in Escherichia coli by multiple polymerase chain reaction. FEMS. 12: 85-90.